ROUGE

Gene/Protein Characteristic Table for mKIAA0363

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AB182283
Description :
Clone Name :	mfj63136 [Vector Info]
Source :	Mouse fetal brain
Note :	We replaced mpk01276, former representative clones for mKIAA0363 with mfj63136. (2004/6/22)

Features of the cloned DNA sequence	Description

Length: 4409 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 71 bp

Genome contig ID gi65527427r_6392613
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
AGCTCTGCAGCCCAATAAAGCCGTGTCACATGATC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACCCTCTGGAGTCCCCTCAGTTCTGTGGTATCATCTCATCACCCCTAGGT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0363 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0363	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..4338
Length: 1445 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q5SWP3	0	99.2	NAC-alpha domai...	Mus musculus
XP_214092	0	83.7	similar to Nasc...	Rattus norvegicus
XP_001133202	5.2e-92	56.0	similar to NAC-...	Homo sapiens
XP_001717233	7.1e-92	56.2	similar to NAC-...	Homo sapiens
XP_166571	3.9e-90	54.8	NAC alpha domai...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
BC029830	2.5e-16	62.3	mKIAA4059

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002715 1297 1355 PF01849 Nascent polypeptide-associated complex NAC

ProfileScan IPR000694 48 186 PS50099 Proline-rich region

NULL 217 295 PS50324 NULL

IPR000694 1083 1200 PS50099 Proline-rich region

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002715	1297	1355	PF01849	Nascent polypeptide-associated complex NAC
ProfileScan	IPR000694	48	186	PS50099	Proline-rich region
NULL	217	295	PS50324	NULL
IPR000694	1083	1200	PS50099	Proline-rich region

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	71 bp
Genome contig ID	gi65527427r_6392613
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- AGCTCTGCAGCCCAATAAAGCCGTGTCACATGATC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACCCTCTGGAGTCCCCTCAGTTCTGTGGTATCATCTCATCACCCCTAGGT

Gene/Protein Characteristic Table for mKIAA0363

Features of the cloned DNA sequence

Features of the protein sequence