ROUGE

Gene/Protein Characteristic Table for mFLJ00274

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220153
Description :	FYVE, RhoGEF and PH domain containing 5.
Clone Name :	mpf00869 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 6096 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1399 bp

Genome contig ID gi65504368f_92326922
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
AAATTCCAGAAATAAAAGTGCATGAATTTCCAGTC
Flanking genome sequence
(197041 - 197090)
----+----*----+----*----+----*----+----*----+----*
ATTTTTACTTGTAGTATAAATGTCCTACTGCATTAGTTAAGCTTCTCTAG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00274 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
FLJ00274	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 105..4697
Length: 1530 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD90339	100.0	mFLJ00274 prote...	Mus musculus
AAI50787	99.9	FYVE, RhoGEF an...	Mus musculus
NP_766319	99.9	FYVE, RhoGEF an...	Mus musculus
Q80UZ0	100.0	FYVE, RhoGEF an...	Mus musculus
AAI45503	96.5	Fgd5 protein [M...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK173157	6.9e-45	30.4	mKIAA1362
BC011462	2.1e-09	25.0	mKIAA4239

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000219 962 1150 PF00621 DH

IPR001849 1181 1274 PF00169 Pleckstrin-like

IPR000306 1304 1369 PF01363 Zinc finger

IPR001849 1432 1529 PF00169 Pleckstrin-like

HMMSmart IPR000219 962 1150 SM00325 DH

IPR001849 1181 1276 SM00233 Pleckstrin-like

IPR000306 1301 1369 SM00064 Zinc finger

IPR001849 1432 1530 SM00233 Pleckstrin-like

ProfileScan IPR000694 23 76 PS50099 Proline-rich region

NULL 137 451 PS50313 NULL

IPR000219 958 1151 PS50010 DH

IPR001849 1180 1274 PS50003 Pleckstrin-like

IPR000306 1315 1368 PS50178 Zinc finger

IPR001849 1431 1529 PS50003 Pleckstrin-like

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000219	962	1150	PF00621	DH
IPR001849	1181	1274	PF00169	Pleckstrin-like
IPR000306	1304	1369	PF01363	Zinc finger
IPR001849	1432	1529	PF00169	Pleckstrin-like
HMMSmart	IPR000219	962	1150	SM00325	DH
IPR001849	1181	1276	SM00233	Pleckstrin-like
IPR000306	1301	1369	SM00064	Zinc finger
IPR001849	1432	1530	SM00233	Pleckstrin-like
ProfileScan	IPR000694	23	76	PS50099	Proline-rich region
NULL	137	451	PS50313	NULL
IPR000219	958	1151	PS50010	DH
IPR001849	1180	1274	PS50003	Pleckstrin-like
IPR000306	1315	1368	PS50178	Zinc finger
IPR001849	1431	1529	PS50003	Pleckstrin-like

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1399 bp
Genome contig ID	gi65504368f_92326922
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- AAATTCCAGAAATAAAAGTGCATGAATTTCCAGTC
Flanking genome sequence (197041 - 197090)	----+--------+--------+--------+--------+----* ATTTTTACTTGTAGTATAAATGTCCTACTGCATTAGTTAAGCTTCTCTAG

Gene/Protein Characteristic Table for mFLJ00274

Features of the cloned DNA sequence

Features of the protein sequence