HUGE |
Gene/Protein Characteristic Table for KIAA1149 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK04248 |
---|---|
Accession No. : | AB032975 |
Description : | Beta-secretase 1 precursor. |
HUGO Gene Name : | |
Clone Name : | fg04087 [Vector Info] |
Source : | Human fetal brain |
Note : | We replaced hg01289, former representative clones for KIAA1149 with fg04087. (2001/5/29) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5814 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 3865 bp Genome contig ID gi51511727r_116561627 PolyA signal sequence
(AGTAAA,-23) +----*----+----*----+----*----+----
GAGCGTTAACACAGTAAAATATTCAATAAGAAGTCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAACTACTAGGGTTACTTTTTTTTCCTCAATCAGAGTCTCATTTTATCCA
Chr f/r start end exon identity class ContigView(URL based/DAS) 11 r 116661627 116692163 9 99.2 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 532 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TCTAGCTCGGAACTTACTGTG | |
: ATAATAGGCTGATGGGACTTG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 11 |
: GeneBridge 4 | |
: GAAAATAGGGTGGACAGAAGC | |
: TCACAGTCCGAGAATAACAAC | |
: 77 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |