Gene/Protein Characteristic Table for KIAA1773
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK01696
Accession No AB053446
Description dachsous cadherin-related 1
Clone name hj00752s2
Vector information
The cDNA fragment was inserted at ApaI-NotI site of the pBlu ...
cDNA sequence DNA sequence (10759 bp)
Predicted protein sequence (3434 aa)
Flexi ORF Clone FXC01696
Source Human adult brain
Note We replaced hj00752x1, former representative clones for KIAA1773 with hj00752s2. (2005/08/06)
Features of the cloned cDNA sequence
Description

Length: 10759 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning Warning
Integrity of 3' end
Length of 3'UTR 452 bp
Genome contig ID gi51511727r_6499134
PolyA signal sequence
(AATAAA,-21)		 
+----*----+----*----+----*----+----
CACTCTGGAGCCTTAATAAACTGCAATTTGTATCC
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
AGTCTCCAGCTTTGTTCTATAGGGATGACTGGAAGACACCTGGCAGAGTA

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 11 r 6599134 6633661 21 99.8 Perfect prediction
Features of the protein sequence
Description

Length: 3434 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q96JQ0 0 100.0 Protocadherin-1...
 Homo sapiens
XP_001100797 0 97.7 similar to dach...
 Macaca mulatta
XP_001918122 0 94.8 dachsous 1 (Dro...
 Equus caballus
XP_987639 0 92.5 similar to dach...
 Mus musculus
EDL16822 0 92.6 mCG19711 [Mus m...
 Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB002325 2.5e-32 33.7 KIAA0327
AB011160 4.8e-31 34.4 KIAA0588
AB046841 4e-28 33.2 KIAA1621
D87469 3.2e-20 33.7 KIAA0279
AB053448 1.3e-19 29.9 KIAA1775
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR002126 226 245 PR00205 Cadherin
IPR002126 391 420 PR00205 Cadherin
IPR002126 463 475 PR00205 Cadherin
IPR002126 693 712 PR00205 Cadherin
IPR002126 924 937 PR00205 Cadherin
IPR002126 1186 1212 PR00205 Cadherin
IPR002126 1223 1240 PR00205 Cadherin
HMMPfam IPR002126 183 270 PF00028 Cadherin
IPR002126 303 382 PF00028 Cadherin
IPR002126 396 489 PF00028 Cadherin
IPR002126 510 599 PF00028 Cadherin
IPR002126 614 705 PF00028 Cadherin
IPR002126 719 812 PF00028 Cadherin
IPR002126 826 917 PF00028 Cadherin
IPR002126 931 1021 PF00028 Cadherin
IPR002126 1035 1125 PF00028 Cadherin
IPR002126 1141 1232 PF00028 Cadherin
IPR002126 1246 1338 PF00028 Cadherin
IPR002126 1358 1448 PF00028 Cadherin
IPR002126 1473 1563 PF00028 Cadherin
IPR002126 1577 1673 PF00028 Cadherin
IPR002126 1686 1776 PF00028 Cadherin
IPR002126 1790 1878 PF00028 Cadherin
IPR002126 1892 1982 PF00028 Cadherin
IPR002126 1996 2087 PF00028 Cadherin
IPR002126 2119 2195 PF00028 Cadherin
IPR002126 2209 2298 PF00028 Cadherin
IPR002126 2312 2404 PF00028 Cadherin
IPR002126 2417 2503 PF00028 Cadherin
IPR002126 2517 2609 PF00028 Cadherin
IPR002126 2623 2729 PF00028 Cadherin
IPR002126 2743 2833 PF00028 Cadherin
IPR002126 2847 2940 PF00028 Cadherin
IPR002126 2954 3007 PF00028 Cadherin
HMMSmart IPR002126 200 277 SM00112 Cadherin
IPR002126 301 389 SM00112 Cadherin
IPR002126 413 496 SM00112 Cadherin
IPR002126 524 606 SM00112 Cadherin
IPR002126 631 712 SM00112 Cadherin
IPR002126 736 819 SM00112 Cadherin
IPR002126 843 924 SM00112 Cadherin
IPR002126 948 1028 SM00112 Cadherin
IPR002126 1052 1132 SM00112 Cadherin
IPR002126 1158 1239 SM00112 Cadherin
IPR002126 1263 1345 SM00112 Cadherin
IPR002126 1375 1455 SM00112 Cadherin
IPR002126 1487 1570 SM00112 Cadherin
IPR002126 1594 1680 SM00112 Cadherin
IPR002126 1703 1783 SM00112 Cadherin
IPR002126 1807 1885 SM00112 Cadherin
IPR002126 1908 1989 SM00112 Cadherin
IPR002126 2013 2094 SM00112 Cadherin
IPR002126 2122 2202 SM00112 Cadherin
IPR002126 2226 2305 SM00112 Cadherin
IPR002126 2329 2411 SM00112 Cadherin
IPR002126 2434 2510 SM00112 Cadherin
IPR002126 2534 2616 SM00112 Cadherin
IPR002126 2640 2736 SM00112 Cadherin
IPR002126 2760 2840 SM00112 Cadherin
IPR002126 2864 2947 SM00112 Cadherin
IPR002126 2971 3062 SM00112 Cadherin
ProfileScan IPR002126 179 279 PS50268 Cadherin
IPR002126 280 391 PS50268 Cadherin
IPR002126 392 498 PS50268 Cadherin
IPR002126 510 608 PS50268 Cadherin
IPR002126 618 714 PS50268 Cadherin
IPR002126 715 821 PS50268 Cadherin
IPR002126 822 926 PS50268 Cadherin
IPR002126 927 1030 PS50268 Cadherin
IPR002126 1031 1136 PS50268 Cadherin
IPR002126 1137 1247 PS50268 Cadherin
IPR002126 1242 1347 PS50268 Cadherin
IPR002126 1360 1460 PS50268 Cadherin
IPR002126 1469 1572 PS50268 Cadherin
IPR002126 1573 1682 PS50268 Cadherin
IPR002126 1682 1785 PS50268 Cadherin
IPR002126 1786 1887 PS50268 Cadherin
IPR002126 1888 1991 PS50268 Cadherin
IPR002126 1992 2096 PS50268 Cadherin
IPR002126 2119 2204 PS50268 Cadherin
IPR002126 2205 2307 PS50268 Cadherin
IPR002126 2308 2413 PS50268 Cadherin
IPR002126 2413 2512 PS50268 Cadherin
IPR002126 2513 2618 PS50268 Cadherin
IPR002126 2619 2738 PS50268 Cadherin
IPR002126 2739 2842 PS50268 Cadherin
IPR002126 2843 2949 PS50268 Cadherin
IPR002126 2950 3069 PS50268 Cadherin
ScanRegExp IPR002126 267 277 PS00232 Cadherin
IPR002126 379 389 PS00232 Cadherin
IPR002126 486 496 PS00232 Cadherin
IPR002126 596 606 PS00232 Cadherin
IPR002126 702 712 PS00232 Cadherin
IPR002126 809 819 PS00232 Cadherin
IPR002126 1018 1028 PS00232 Cadherin
IPR002126 1335 1345 PS00232 Cadherin
IPR002126 1670 1680 PS00232 Cadherin
IPR002126 1875 1885 PS00232 Cadherin
IPR002126 1979 1989 PS00232 Cadherin
IPR002126 2084 2094 PS00232 Cadherin
IPR002126 2295 2305 PS00232 Cadherin
IPR002126 2401 2411 PS00232 Cadherin
IPR002126 2500 2510 PS00232 Cadherin
IPR002126 2606 2616 PS00232 Cadherin
IPR002126 2726 2736 PS00232 Cadherin
IPR002126 2830 2840 PS00232 Cadherin

Prediction of transmembrane (TM) segments
Method No. N terminal transmembrane region C terminal type length
SOSUI2 1 154 RPHLLLPLLLLLLLLLGAGVPGA 176 PRIMARY 23
2 199 DISAGLPAGTAAPLMYFISAQE 220 SECONDARY 22
3 3074 VGAVAASLGVVVVLALAALVLGL 3096 PRIMARY 23
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f ACCCTGAGATGGAGCTGAGAC
Primer_r CAGTTTATTAAGGCTCCAGAG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 11
Experimental conditions
Panel name GeneBridge 4
Primer_f GCTGTGGAGGATGAGAATGAC
Primer_r CGAAGCATGGTAAGGGTCTGG
PCR product length 101 bp
PCR conditions 95 °C15 sec66 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp