KIAA0032

Product ID	ORK00376
Accession No	D25215
Description	HECT and RLD domain containing E3 ubiquitin protein ligase 3, transcript variant 1
Clone name	ha01920
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4894 bp) Predicted protein sequence (1054 aa)
HaloTag ORF Clone	FHC00376
Flexi ORF Clone	FXC00376
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0032 by Kazusa Mouse cDNA Project

Length: 4894 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1575 bp
Genome contig ID	gi89161207f_89632670
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TTCAATATTATGCAATAAATTTGGTGTTTTAACTT
Flanking genome sequence (216041 - 216090)	----+--------+--------+--------+--------+----* AAAACTATTTCTTATTGTACTTGCAGAATGGATAGCTTGCTTTTAGTAGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	f	89732670	89848709	26	100.0	Perfect prediction

Length: 1054 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q15034	100.0	Probable E3 ubi...	Homo sapiens
XP_001100859	99.7	hect domain and...	Macaca mulatta
XP_001496703	98.5	similar to Prob...	Equus caballus
XP_535653	98.6	similar to HECT...	Canis lupus fam...
AAI33342	97.9	HERC3 protein [...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046813	5e-217	56.5	KIAA1593
AB037722	2e-35	31.2	KIAA1301
AB007899	2e-35	30.9	KIAA0439
D42055	3.7e-34	31.1	KIAA0093
AB002320	1.8e-32	29.8	KIAA0322

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000408	4	20	PR00633	Regulator of chromosome condensation
	IPR000408	40	53	PR00633	Regulator of chromosome condensation
	IPR000408	59	75	PR00633	Regulator of chromosome condensation
	IPR000408	107	123	PR00633	Regulator of chromosome condensation
	IPR000408	146	162	PR00633	Regulator of chromosome condensation
	IPR000408	162	176	PR00633	Regulator of chromosome condensation
	IPR000408	254	272	PR00633	Regulator of chromosome condensation
	IPR000408	313	334	PR00633	Regulator of chromosome condensation
HMMPfam	IPR000408	56	103	PF00415	Regulator of chromosome condensation
	IPR000408	106	156	PF00415	Regulator of chromosome condensation
	IPR000408	159	209	PF00415	Regulator of chromosome condensation
	IPR000408	212	261	PF00415	Regulator of chromosome condensation
	IPR000569	756	1054	PF00632	HECT
HMMSmart	IPR000569	725	1054	SM00119	HECT
ProfileScan	IPR000408	3	56	PS50012	Regulator of chromosome condensation
	IPR000408	57	106	PS50012	Regulator of chromosome condensation
	IPR000408	107	159	PS50012	Regulator of chromosome condensation
	IPR000408	160	212	PS50012	Regulator of chromosome condensation
	IPR000408	213	264	PS50012	Regulator of chromosome condensation
	IPR000408	265	316	PS50012	Regulator of chromosome condensation
	IPR000408	318	384	PS50012	Regulator of chromosome condensation
	IPR000569	727	1054	PS50237	HECT
ScanRegExp	IPR000408	43	53	PS00626	Regulator of chromosome condensation
	IPR000408	93	103	PS00626	Regulator of chromosome condensation
	IPR000408	251	261	PS00626	Regulator of chromosome condensation

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	CAACCTTCCTCATCATGG
Primer_r	CTACAATCCTTCATCAAG
PCR product length	156 bp
PCR conditions	95 °C15 sec53 °C60 sec30 cycles