KIAA1593

Product ID	ORK05416
Accession No	AB046813
Description	HECT and RLD domain containing E3 ubiquitin protein ligase 4
Clone name	fj09260
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4362 bp) Predicted protein sequence (953 aa)
Source	Human fetal brain
Rouge ID	mKIAA1593 by Kazusa Mouse cDNA Project

Length: 4362 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1023 bp
Genome contig ID	gi89161187r_69251671
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- AAACTGTTTAATAAAGATTTATTGTTTTAATATTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAACTTTCAGTGGTTCTCATATAAGAGTCAAAATTTTTCAAAAAGAGGGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	r	69351671	69469730	23	100.0	Perfect prediction

Length: 953 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001167574	99.6	hect domain and...	Pan troglodytes
EAW54265	100.0	hect domain and...	Homo sapiens
XP_001087376	98.6	similar to hect...	Macaca mulatta
XP_001167627	99.6	hect domain and...	Pan troglodytes
XP_001086908	98.7	similar to hect...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D25215	7e-213	56.5	KIAA0032
AB037722	1.2e-33	31.4	KIAA1301
AB007899	9.4e-33	30.8	KIAA0439
AB002320	1.6e-32	31.0	KIAA0322
D42055	1e-31	31.3	KIAA0093

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000408	38	54	PR00633	Regulator of chromosome condensation
	IPR000408	54	68	PR00633	Regulator of chromosome condensation
	IPR000408	146	164	PR00633	Regulator of chromosome condensation
	IPR000408	205	226	PR00633	Regulator of chromosome condensation
HMMPfam	IPR000408	53	101	PF00415	Regulator of chromosome condensation
	IPR000408	104	153	PF00415	Regulator of chromosome condensation
	IPR000569	655	953	PF00632	HECT
HMMSmart	IPR000569	624	953	SM00119	HECT
ProfileScan	IPR000408	52	104	PS50012	Regulator of chromosome condensation
	IPR000408	105	156	PS50012	Regulator of chromosome condensation
	IPR000408	157	208	PS50012	Regulator of chromosome condensation
	IPR000408	210	276	PS50012	Regulator of chromosome condensation
	IPR000569	626	953	PS50237	HECT
ScanRegExp	IPR000408	38	48	PS00626	Regulator of chromosome condensation
ScanRegExp	IPR000408	143	153	PS00626	Regulator of chromosome condensation

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1	SCFPKIMCVDSLVRICSGLSYGR	23	SECONDARY	23
SOSUI2	2	690	LFHLIGVICGLAIYNCTIVDLHF	712	PRIMARY	23

Primer_f	AACAGCAGGCCTATGGAATGG
Primer_r	ATAGCCATCTGCATCTGTAAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-