KIAA0019

Product ID	ORK00366
Accession No	D13644
Description	USP6 N-terminal like, transcript variant 1
Clone name	ha00537
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4602 bp) Predicted protein sequence (838 aa)
HaloTag ORF Clone	FHC00366
Flexi ORF Clone	FXC00366
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0019 by Kazusa Mouse cDNA Project

Length: 4602 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1836 bp
Genome contig ID	gi89161187r_11442661
PolyA signal sequence (AATATA,-21)	+--------+--------+----*----+---- ATATATATGCAAAAAATATATATATACACACAAGC
Flanking genome sequence (99942 - 99893)	----+--------+--------+--------+--------+----* ACTATTTTCTTATGTCATTTATGACATTTTTTATCTGTATACTTTTTTGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	r	11542603	11693643	15	99.3	Perfect prediction

Length: 838 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q92738	100.0	USP6 N-terminal...	Homo sapiens
BAF85633	99.9	unnamed protein...	Homo sapiens
CAL38244	99.9	hypothetical pr...	synthetic construct
CAL37548	99.9	hypothetical pr...	synthetic construct
NP_001073960	98.9	USP6 N-terminal...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029031	1.1e-08	26.9	KIAA1108
AB011175	4e-07	28.8	KIAA0603
AB014576	4e-06	27.1	KIAA0676
AB011180	5.6e-06	27.5	KIAA0608
AB028978	6.9e-06	24.3	KIAA1055

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000195	107	324	PF00566	RabGAP/TBC
HMMSmart	IPR000195	107	325	SM00164	RabGAP/TBC
ProfileScan	IPR000195	110	302	PS50086	RabGAP/TBC

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	TCACATCCACATACTAAGAG
Primer_r	GCAGAAGAAAGAAGTAACCA
PCR product length	176 bp
PCR conditions	95 °C15 sec58 °C60 sec30 cycles