Order Kazusa clone(s) from : ![]() |
Product ID | ORK00310 |
---|---|
Accession No | AB095941 |
Description | NOP9 nucleolar protein, transcript variant 1 |
Clone name | ah05004 |
Vector information | |
cDNA sequence | DNA sequence (6033 bp) Predicted protein sequence (648 aa) |
HaloTag ORF Clone |
FHC00310
![]() |
Flexi ORF Clone | FXC00310 |
Source | Human brain (amygdala) |
Rouge ID |
mKIAA2021
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 4029 bp |
---|---|
Genome contig ID | gi51511730f_23738908 |
PolyA signal sequence (AATAAA,-20) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (109264 - 109313) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 14 | f | 23838908 | 23848170 | 10 | 99.3 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001313 | 104 | 135 | PF00806 | Pumilio/Puf RNA-binding |
IPR001313 | 201 | 235 | PF00806 | Pumilio/Puf RNA-binding | |
IPR001313 | 325 | 360 | PF00806 | Pumilio/Puf RNA-binding | |
IPR001313 | 363 | 398 | PF00806 | Pumilio/Puf RNA-binding | |
IPR001313 | 521 | 556 | PF00806 | Pumilio/Puf RNA-binding | |
IPR001313 | 559 | 593 | PF00806 | Pumilio/Puf RNA-binding | |
HMMSmart | IPR001313 | 201 | 232 | SM00025 | Pumilio/Puf RNA-binding |
IPR001313 | 275 | 310 | SM00025 | Pumilio/Puf RNA-binding | |
IPR001313 | 326 | 361 | SM00025 | Pumilio/Puf RNA-binding | |
IPR001313 | 363 | 399 | SM00025 | Pumilio/Puf RNA-binding | |
IPR001313 | 521 | 558 | SM00025 | Pumilio/Puf RNA-binding | |
IPR001313 | 559 | 594 | SM00025 | Pumilio/Puf RNA-binding |
![]() |
Primer_f | GTAGGGGATTAGATGTAGCAG |
---|---|
Primer_r | CCTTTCAGCATAACGCCTCAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |