KIAA1597

Product ID	ORK00253
Accession No	AB046817
Description	synaptotagmin-like 2
Clone name	fj09819
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4251 bp) Predicted protein sequence (913 aa)
HaloTag ORF Clone	FHC00253
Flexi ORF Clone	FXC00253
Source	Human fetal brain
Rouge ID	mKIAA1597 by Kazusa Mouse cDNA Project

Length: 4251 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	912 bp
Genome contig ID	gi51511727r_84982975
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- ACCCTTAGAATAAATTATCATTTGATTTAAATTGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTAGAAAATTAGCGTGACTTCTCATTTTAAATAAAATATTTTAGGAATT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	r	85082975	85199826	20	99.6	Internal No-hit

Length: 913 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW75111	99.9	synaptotagmin-l...	Homo sapiens
BAG10475	100.0	synaptotagmin-l...	synthetic construct
Q9HCH5	99.9	Synaptotagmin-l...	Homo sapiens
EAW75107	99.7	synaptotagmin-l...	Homo sapiens
XP_001175275	98.9	synaptotagmin-l...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023202	3.4e-05	22.3	KIAA0985

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000008	640	652	PR00360	C2 calcium-dependent membrane targeting
FPrintScan	IPR000008	669	682	PR00360	C2 calcium-dependent membrane targeting
HMMPfam	IPR000008	624	713	PF00168	C2 calcium-dependent membrane targeting
HMMPfam	IPR000008	773	860	PF00168	C2 calcium-dependent membrane targeting
HMMSmart	IPR000008	623	728	SM00239	C2 calcium-dependent membrane targeting
HMMSmart	IPR000008	772	875	SM00239	C2 calcium-dependent membrane targeting
ProfileScan	IPR010911	4	60	PS50916	Rab-binding
	IPR000008	623	713	PS50004	C2 calcium-dependent membrane targeting
	IPR000008	772	860	PS50004	C2 calcium-dependent membrane targeting

Primer_f	ACTGAAGTGGACTGGATGGAC
Primer_r	TTCAAGATCAGATTCCACCGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	CCR
Primer_f	ACTGAAGTGGACTGGATGGAC
Primer_r	TTCAAGATCAGATTCCACCGG
PCR product length	192 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles