KIAA1415

Product ID	ORK06477
Accession No	AB037836
Description	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1
Clone name	hg04328s1
Vector information	The cDNA fragment was inserted at the NotI-NotI site of the ... The cDNA fragment was inserted at the NotI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The adjacent vector sequence to the 5' end of the cDNA is as follows: CCCGGGGGAT CCACTAGTTC TAGAGCG-5' end of cDNA. The cDNA was prepared by subcloning using three cDNA fragments corresponding to 1-395, 396-2550 and 2551-6496.
cDNA sequence	DNA sequence (6496 bp) Predicted protein sequence (1621 aa)
Source	Human adult brain
Rouge ID	mKIAA1415 by Kazusa Mouse cDNA Project
Note	We replaced hg04328, former representative clones for KIAA1415 with hg04328s1. (2002/5/10)

Length: 6496 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	1630 bp
Genome contig ID	gi51511747r_46574200
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- ATTTTTTATTATTATTAAAAGTCAGTTTATAATAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAGAACGAGGCTGTGATCTGCTTCATCTGCGGTGGGTGGCTTGGGGGGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	20	r	46674200	46877690	40	99.9	Perfect prediction

Length: 1621 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW75684	100.0	phosphatidylino...	Homo sapiens
CAC86401	99.9	P-Rex1 protein ...	Homo sapiens
Q8TCU6	99.9	Phosphatidylino...	Homo sapiens
XP_605801	93.9	similar to PREX...	Bos taurus
Q69ZK0	91.3	Phosphatidylino...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029035	1.3e-27	36.4	KIAA1112
AB007884	3e-24	34.2	KIAA0424
AB002335	7.9e-14	30.9	KIAA0337
AB018336	1.5e-11	28.9	KIAA0793
AB033082	2e-11	25.9	KIAA1256

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000219	15	201	PF00621	DH
	IPR001849	234	354	PF00169	Pleckstrin-like
	IPR000591	383	456	PF00610	Pleckstrin/ G-protein
	IPR000591	485	557	PF00610	Pleckstrin/ G-protein
	IPR001478	588	665	PF00595	PDZ/DHR/GLGF
HMMSmart	IPR000219	15	201	SM00325	DH
	IPR001849	234	356	SM00233	Pleckstrin-like
	IPR000591	385	458	SM00049	Pleckstrin/ G-protein
	IPR000591	486	559	SM00049	Pleckstrin/ G-protein
	IPR001478	595	668	SM00228	PDZ/DHR/GLGF
	IPR001478	679	750	SM00228	PDZ/DHR/GLGF
ProfileScan	IPR000219	11	202	PS50010	DH
	IPR001849	233	354	PS50003	Pleckstrin-like
	IPR000591	383	458	PS50186	Pleckstrin/ G-protein
	IPR000591	491	559	PS50186	Pleckstrin/ G-protein
	IPR001478	587	634	PS50106	PDZ/DHR/GLGF
ScanRegExp	IPR001331	150	175	PS00741	Guanine-nucleotide dissociation stimulator

Primer_f	TTCCTTCAACGTCCACATTCC
Primer_r	TTTTCCAAGTCCACCAAGCAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TTCCTTCAACGTCCACATTCC
Primer_r	TTTTCCAAGTCCACCAAGCAG
PCR product length	107 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles