KIAA0763

Product ID	ORK00628
Accession No	AB018306
Description	IQ motif and Sec7 domain 1
Clone name	hk04726
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4148 bp) Predicted protein sequence (843 aa)
HaloTag ORF Clone	FHC00628
Flexi ORF Clone	FXC00628
Source	Human adult brain
Rouge ID	mKIAA0763 by Kazusa Mouse cDNA Project

Length: 4148 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1516 bp
Genome contig ID	gi89161205r_12814374
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- AATGTAAAAATAAAGTTCATCCTAATATGCTGTGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACATCTTGCTTAAAAATGTCTTCAGCACCCAGTGCAGTGATCTTTCCCTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	r	12914374	12958170	13	99.6	Perfect prediction

Length: 843 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q6DN90	100.0	IQ motif and SE...	Homo sapiens
BAG09837	100.0	IQ motif and Se...	synthetic construct
XP_001083503	99.5	similar to IQ m...	Macaca mulatta
XP_516294	99.5	IQ motif and Se...	Pan troglodytes
NP_001127854	100.0	IQ motif and Se...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011094	1.6e-62	62.5	KIAA0522
AB029033	1.3e-48	59.0	KIAA1110
D87435	1.8e-13	37.7	KIAA0248
AB023159	5.8e-08	30.8	KIAA0942
AB095931	1.4e-07	23.6	KIAA2011

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000048	15	35	PF00612	IQ calmodulin-binding region
HMMPfam	IPR000904	401	592	PF01369	SEC7-like
HMMSmart	IPR000904	401	592	SM00222	SEC7-like
HMMSmart	IPR001849	633	744	SM00233	Pleckstrin-like
ProfileScan	IPR000048	14	43	PS50096	IQ calmodulin-binding region
ProfileScan	IPR000904	397	590	PS50190	SEC7-like

Primer_f	AGCATGGGACCGTGTGATTGG
Primer_r	ACGCCAGATGACATGCAGCAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AGCATGGGACCGTGTGATTGG
Primer_r	ACGCCAGATGACATGCAGCAG
PCR product length	179 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles