ROUGE |
Gene/Protein Characteristic Table for mKIAA4255 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122452 |
---|---|
mbg05755 [Vector Info] | |
Source : | Mouse brain |
Note : | The gene name of mbg05755 was changed from mKIAA1120 to mKIAA4255, because this gene is not a mouse ortholog of KIAA1120 |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5196 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 811 bp Genome contig ID gi65550231r_23080144 PolyA signal sequence
(AATAAA,-22) +----*----+----*----+----*----+----
CAAAGCAAAGCTGAATAAACACTAACTTATTTAAGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAAGACACTTGGGTTGGTTGCTACACCTCATTCAGAGTTCCGAGGCCGCG
Features of the protein sequence |
Description | |
Coding region: 3..4382
Length: 1460 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |