| ROUGE |
Gene/Protein Characteristic Table for mKIAA4255 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK122452 |
|---|---|
| mbg05755 [Vector Info] | |
| Source : | Mouse brain |
| Note : | The gene name of mbg05755 was changed from mKIAA1120 to mKIAA4255, because this gene is not a mouse ortholog of KIAA1120 |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5196 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 811 bp Genome contig ID gi65550231r_23080144 PolyA signal sequence
(AATAAA,-22)
CAAAGCAAAGCTGAATAAACACTAACTTATTTAAGFlanking genome sequence
(100000 - 99951)
AAAGACACTTGGGTTGGTTGCTACACCTCATTCAGAGTTCCGAGGCCGCG
Features of the protein sequence |
Description | |
Coding region: 3..4382
Length: 1460 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage 
| |
