| ROUGE |
Gene/Protein Characteristic Table for mKIAA4252 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK172962 |
|---|---|
| mtg01513 [Vector Info] | |
| Source : | Mouse adult thymus |
| Note : | The gene name of mtg01513 was changed from mKIAA0518 to mKIAA4252, because this gene is not a mouse ortholog of KIAA0518 |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 6995 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 0 bp Genome contig ID gi66880554f_119311155 PolyA signal sequence
(None)
GTATATTTATGCAAAACAACAAGCACTAGAAGCACFlanking genome sequence
(163491 - 163540)
AAAAAAGAAAAAAGAAGCTGGGGTCAGATGAGTTTTGTGTGTCCCCCAGA
Features of the protein sequence |
Description | |
Coding region: 68..6994
Length: 2309 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage 
| |
