ROUGE |
Gene/Protein Characteristic Table for mKIAA4246 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | BC032882 |
---|---|
Interferon-induced guanylate-binding protein 2. | |
msj08227 [Vector Info] | |
Source : | Mouse adult spleen |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2449 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 520 bp Genome contig ID gi65492966f_141492643 PolyA signal sequence
(AATAAA,-23) +----*----+----*----+----*----+----
AGAGCACAAGTTAATAAAAATGATTAGCCCACTGTFlanking genome sequence
(114340 - 114389) ----+----*----+----*----+----*----+----*----+----*
AATTGTTTCTGAATGTGTATTATCATTTGTGGTTCACTAAGGAAACAAAA
Features of the protein sequence |
Description | |
Coding region: 121..1926
Length: 602 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |