ROUGE |
Gene/Protein Characteristic Table for mKIAA4235 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK220561 |
---|---|
Galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase 1 (Fragment). | |
mfj03248 [Vector Info] | |
Source : | Mouse fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3701 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 2206 bp Genome contig ID gi65519420f_26527715 PolyA signal sequence
(ATTAAA,-32) +----*----+----*----+----*----+----
AAAATTAAAAGTCAAATATGGTTTTTAACAGTTGTFlanking genome sequence
(127527 - 127576) ----+----*----+----*----+----*----+----*----+----*
AATCCTCTTCAGCCCCTGTCTTATTTTAGTCTTGTTTATTAATTGAACTG
Features of the protein sequence |
Description | |
Coding region: 311..1492
Length: 394 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |