ROUGE

Gene/Protein Characteristic Table for mKIAA4214

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK004771
Description :	Dihydroxyacetone phosphate acyltransferase.
Clone Name :	mph00667 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 2886 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 734 bp

Genome contig ID gi65515060f_124050447
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
GACAGAAGTGTGTAATAAATTATTTAGTTTACTTT
Flanking genome sequence
(126928 - 126977)
----+----*----+----*----+----*----+----*----+----*
AAACTTTATACCCAATGGTCTTATTAACAAATTGAACTAAACAGAGTGTG

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 77..2149
Length: 691 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
P98192	100.0	Dihydroxyaceton...	Mus musculus
AAH25972	99.9	Glyceronephosph...	Mus musculus
BAE39176	99.9	unnamed protein...	Mus musculus
BAE29873	99.9	unnamed protein...	Mus musculus
Q9ES71	94.1	Dihydroxyaceton...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK173202	3.3e-25	27.2	mKIAA1560

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002123 150 295 PF01553 Phospholipid/glycerol acyltransferase

ProfileScan IPR002123 164 303 PS50239 Phospholipid/glycerol acyltransferase

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002123	150	295	PF01553	Phospholipid/glycerol acyltransferase
ProfileScan	IPR002123	164	303	PS50239	Phospholipid/glycerol acyltransferase

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	734 bp
Genome contig ID	gi65515060f_124050447
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- GACAGAAGTGTGTAATAAATTATTTAGTTTACTTT
Flanking genome sequence (126928 - 126977)	----+--------+--------+--------+--------+----* AAACTTTATACCCAATGGTCTTATTAACAAATTGAACTAAACAGAGTGTG

Gene/Protein Characteristic Table for mKIAA4214

Features of the cloned DNA sequence

Features of the protein sequence