ROUGE |
Gene/Protein Characteristic Table for mKIAA4214 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK004771 |
---|---|
Dihydroxyacetone phosphate acyltransferase. | |
mph00667 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2886 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 734 bp Genome contig ID gi65515060f_124050447 PolyA signal sequence
(AATAAA,-22) +----*----+----*----+----*----+----
GACAGAAGTGTGTAATAAATTATTTAGTTTACTTTFlanking genome sequence
(126928 - 126977) ----+----*----+----*----+----*----+----*----+----*
AAACTTTATACCCAATGGTCTTATTAACAAATTGAACTAAACAGAGTGTG
Features of the protein sequence |
Description | |
Coding region: 77..2149
Length: 691 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |