ROUGE |
Gene/Protein Characteristic Table for mKIAA4200 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK220300 |
---|---|
DEP domain containing 6. | |
mie24089 [Vector Info] | |
Source : | Mouse adult pancreatic islet |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 1890 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 645 bp Genome contig ID gi65543215f_55014440 PolyA signal sequence
(None) +----*----+----*----+----*----+----
AGCCTGGGCAACATAGTGAAACCCCACATTAATTTFlanking genome sequence
(240298 - 240347) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAAGGTTTTACCAATATTAGTCTGAATCTGTT
Features of the protein sequence |
Description | |
Coding region: 1..1242
Length: 414 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |