ROUGE

Gene/Protein Characteristic Table for mKIAA4189

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220534
Description :	Ribulose-phosphate 3-epimerase.
Clone Name :	mfj00047 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 4457 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1411 bp

Genome contig ID gi65488608r_66911771
PolyA signal sequence
(ATTAAA,-17)
+----*----+----*----+----*----+----
CTACATAGTTTTTTTTTAATTAAAGTTATTTCTAT
Flanking genome sequence
(99973 - 99924)
----+----*----+----*----+----*----+----*----+----*
ATGCCTTGTATTGTGTGATTTGATTAAATGCACAAACCTTTCGTAAGCTA

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 185..3043
Length: 953 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAQ52309	100.0	novel protein (...	Mus musculus
AAI41037	99.9	1110028C15Rik p...	Mus musculus
NP_808313	99.5	hypothetical pr...	Mus musculus
XP_346059	94.7	similar to CG46...	Rattus norvegicus
AAI26156	80.2	C2orf67 protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122484	2.8e-27	30.3	mKIAA1267

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ScanRegExp IPR004827 716 729 PS00036 Basic-leucine zipper (bZIP) transcription factor

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ScanRegExp	IPR004827	716	729	PS00036	Basic-leucine zipper (bZIP) transcription factor

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1411 bp
Genome contig ID	gi65488608r_66911771
PolyA signal sequence (ATTAAA,-17)	+--------+--------+----*----+---- CTACATAGTTTTTTTTTAATTAAAGTTATTTCTAT
Flanking genome sequence (99973 - 99924)	----+--------+--------+--------+--------+----* ATGCCTTGTATTGTGTGATTTGATTAAATGCACAAACCTTTCGTAAGCTA

Gene/Protein Characteristic Table for mKIAA4189

Features of the cloned DNA sequence

Features of the protein sequence