ROUGE |
Gene/Protein Characteristic Table for mKIAA4184 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK220530 |
---|---|
glutamate receptor, ionotropic, AMPA3 (alpha 3). cAMP-dependent Rap1 guanine-nucleotide exchange factor. |
|
mbg07034 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4993 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2275 bp Genome contig ID gi66880665f_35822311 PolyA signal sequence
(AATAAA,-20) +----*----+----*----+----*----+----
TTAATACATTTTGTAAATAAAATTGTAAAGAAAGCFlanking genome sequence
(377088 - 377137) ----+----*----+----*----+----*----+----*----+----*
ATTCTGTCTCTGCACTTTGACTAGCTGCTTGCTGTATACTTGATGCAGAT
Features of the protein sequence |
Description | |
Coding region: 1..2715
Length: 905 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |