ROUGE |
Gene/Protein Characteristic Table for mKIAA4180 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK220527 |
---|---|
Transforming acidic coiled-coil-containing protein 2. | |
mtj00050 [Vector Info] | |
Source : | Mouse adult thymus |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3668 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 390 bp Genome contig ID gi65511124f_124933907 PolyA signal sequence
(None) +----*----+----*----+----*----+----
CAATTGATCCACATTTGCTGGTTTGGTTTTTTAGGFlanking genome sequence
(108369 - 108418) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAGAATGCATGTTTCAAATAAAATTCTCTATTGTAAA
Features of the protein sequence |
Description | |
Coding region: 2805..3275
Length: 157 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |