ROUGE |
Gene/Protein Characteristic Table for mFLJ00319 |
Link to : NEDO | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK220245 |
---|---|
galactosamine (N-acetyl)-6-sulfate sulfatase. N-acetylgalactosamine-6-sulfate sulfatase. |
|
mib36033 [Vector Info] | |
Source : | Mouse adult pancreatic islet |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2487 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 873 bp Genome contig ID gi65515060r_121859976 PolyA signal sequence
(ATTAAA,-31) +----*----+----*----+----*----+----
TGGGATTAAAGGCGTGCGCCATCATGAGACCACCTFlanking genome sequence
(99850 - 99801) ----+----*----+----*----+----*----+----*----+----*
ATCCTGGTCTTTTGTTTGTTTGTTTGTTTTTATTTTTTTCAAGGCAGGGT
KIAA Alignment based on: FLJ00319 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 1..1614
Length: 537 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |