ROUGE |
Gene/Protein Characteristic Table for mKIAA4154 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | BC065098 |
---|---|
FAS-associated factor 1. | |
mpj02503 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2398 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 161 bp Genome contig ID gi65493515f_108535647 PolyA signal sequence
(AATAAA,-17) +----*----+----*----+----*----+----
AGATTGCTGGAAAAAAGTAATAAACATAGCTACTTFlanking genome sequence
(385304 - 385353) ----+----*----+----*----+----*----+----*----+----*
AAAATTTCCCATCCATGAGTATATGTTCCCCGCTCCTCATGACGGAGTGC
Features of the protein sequence |
Description | |
Coding region: 129..2234
Length: 702 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |