ROUGE

Gene/Protein Characteristic Table for mKIAA4154

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	BC065098
Description :	FAS-associated factor 1.
Clone Name :	mpj02503 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 2398 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 161 bp

Genome contig ID gi65493515f_108535647
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
AGATTGCTGGAAAAAAGTAATAAACATAGCTACTT
Flanking genome sequence
(385304 - 385353)
----+----*----+----*----+----*----+----*----+----*
AAAATTTCCCATCCATGAGTATATGTTCCCCGCTCCTCATGACGGAGTGC

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 129..2234
Length: 702 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH65098	100.0	Fas-associated ...	Mus musculus
P54731	99.4	FAS-associated ...	Mus musculus
EDL90354	99.1	Fas-associated ...	Rattus norvegicus
XP_001104146	91.5	FAS-associated ...	Macaca mulatta
Q924K2	98.6	FAS-associated ...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122394	1.4e-05	29.0	mKIAA0887
AK129218	0.00046	28.9	mKIAA0794

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001012 620 700 PF00789 UBX

HMMSmart IPR001012 618 700 SM00166 UBX

ProfileScan IPR001012 621 698 PS50033 UBX

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001012	620	700	PF00789	UBX
HMMSmart	IPR001012	618	700	SM00166	UBX
ProfileScan	IPR001012	621	698	PS50033	UBX

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	161 bp
Genome contig ID	gi65493515f_108535647
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- AGATTGCTGGAAAAAAGTAATAAACATAGCTACTT
Flanking genome sequence (385304 - 385353)	----+--------+--------+--------+--------+----* AAAATTTCCCATCCATGAGTATATGTTCCCCGCTCCTCATGACGGAGTGC

Gene/Protein Characteristic Table for mKIAA4154

Features of the cloned DNA sequence

Features of the protein sequence