ROUGE

Gene/Protein Characteristic Table for mKIAA0794

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129218
Description :
Clone Name :	mph02383 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 2924 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1820 bp

Genome contig ID gi65546577f_31078698
PolyA signal sequence
(TATAAA,-33)
+----*----+----*----+----*----+----
TTTATAAATATATTTATATAATTACAATTTCATTT
Flanking genome sequence
(117431 - 117480)
----+----*----+----*----+----*----+----*----+----*
ATACCTTGAGTCAAAGTTCTCTCTTTTGATTGGTGACTGAACAATACCAC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0794 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0794	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..1104
Length: 367 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q6P5G6	4.1e-145	100.0	UBX domain-cont...	Mus musculus
AAH62904	4.2e-145	100.0	Ubxn7 protein [...	Mus musculus
BAE28100	4.3e-145	100.0	unnamed protein...	Mus musculus
EDK97783	4.3e-145	100.0	mCG129950, isof...	Mus musculus
EDM11426	7.3e-145	99.7	rCG52671, isofo...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
BC065098	3e-05	28.9	mKIAA4154

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001012 285 365 PF00789 UBX

HMMSmart IPR001012 283 365 SM00166 UBX

ProfileScan IPR001012 286 363 PS50033 UBX

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001012	285	365	PF00789	UBX
HMMSmart	IPR001012	283	365	SM00166	UBX
ProfileScan	IPR001012	286	363	PS50033	UBX

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1820 bp
Genome contig ID	gi65546577f_31078698
PolyA signal sequence (TATAAA,-33)	+--------+--------+----*----+---- TTTATAAATATATTTATATAATTACAATTTCATTT
Flanking genome sequence (117431 - 117480)	----+--------+--------+--------+--------+----* ATACCTTGAGTCAAAGTTCTCTCTTTTGATTGGTGACTGAACAATACCAC

Gene/Protein Characteristic Table for mKIAA0794

Features of the cloned DNA sequence

Features of the protein sequence