ROUGE

Gene/Protein Characteristic Table for mKIAA4126

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220292
Description :	Paired amphipathic helix protein Sin3a.
Clone Name :	mic04070 [Vector Info]
Source :	Mouse adult pancreatic islet

Features of the cloned DNA sequence	Description

Length: 5078 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 980 bp

Genome contig ID gi65519420f_57089965
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TTTTTTTAAATGTAAATAAAGCTTGATTCTTAAGG
Flanking genome sequence
(151885 - 151934)
----+----*----+----*----+----*----+----*----+----*
AAATAAGTAACATAAGTCCCTTGTCCTCTCCAAAGAGCTGTTGTAAAGTT

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 241..4095
Length: 1285 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_001103820	100.0	transcriptional...	Mus musculus
Q60520	99.6	Paired amphipat...	Mus musculus
EDL25883	99.8	transcriptional...	Mus musculus
AAA89119	99.7	mSin3A.	Mus musculus
AAB01610	99.1	transcription r...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK173005	2.5e-66	52.0	mKIAA0700

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003822 149 195 PF02671 Paired amphipathic helix

IPR003822 330 389 PF02671 Paired amphipathic helix

IPR003822 486 532 PF02671 Paired amphipathic helix

NULL 559 659 PF08295 NULL

ProfileScan IPR000694 226 293 PS50099 Proline-rich region

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003822	149	195	PF02671	Paired amphipathic helix
IPR003822	330	389	PF02671	Paired amphipathic helix
IPR003822	486	532	PF02671	Paired amphipathic helix
NULL	559	659	PF08295	NULL
ProfileScan	IPR000694	226	293	PS50099	Proline-rich region

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	980 bp
Genome contig ID	gi65519420f_57089965
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TTTTTTTAAATGTAAATAAAGCTTGATTCTTAAGG
Flanking genome sequence (151885 - 151934)	----+--------+--------+--------+--------+----* AAATAAGTAACATAAGTCCCTTGTCCTCTCCAAAGAGCTGTTGTAAAGTT

Gene/Protein Characteristic Table for mKIAA4126

Features of the cloned DNA sequence

Features of the protein sequence