ROUGE |
Gene/Protein Characteristic Table for mKIAA0700 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK173005 |
---|---|
Paired amphipathic helix protein Sin3b. | |
mbg16185 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6080 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 793 bp Genome contig ID gi65515060f_71773347 PolyA signal sequence
(ATTAAA,-19) +----*----+----*----+----*----+----
TTCTATTTATTTGCACATTAAAGTTAAATATTGATFlanking genome sequence
(135209 - 135258) ----+----*----+----*----+----*----+----*----+----*
GCCAAGCCTCAGGGTCCTTCGTCATTTCCTACAAAAGTCCCAGCCAGGTC
KIAA Alignment based on: KIAA0700 DNA sequence, AA sequence
Features of the protein sequence |
Description | |
Coding region: 1..831, 2813..5287
Length: 1101 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |