ROUGE

Gene/Protein Characteristic Table for mKIAA4084

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AF297083
Description :	guanylate cyclase 1, soluble, beta 3. soluble guanylate cyclase beta-1 subunit. beta 1 sGC.
Clone Name :	mfj00113 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 3217 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1250 bp

Genome contig ID gi65492966r_81661066
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
AGTGCGCATTAATTTAATAAAATGGTATTGACACT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACTTGCGATTTTTCTTAATCTTTTATTTAAAGGCATTTTATAACCTTGTT

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 87..1964
Length: 626 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O54865	100.0	Guanylate cycla...	Mus musculus
Q02153	98.9	Guanylate cycla...	Homo sapiens
Q4ZHR9	98.9	Guanylate cycla...	Canis lupus fam...
P20595	98.9	Guanylate cycla...	Rattus norvegicus
EAX04889	98.5	guanylate cycla...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
U30602	1.1e-16	37.2	mKIAA0520
AK122279	9.2e-15	30.2	mKIAA0422
AK220469	6.9e-10	32.1	mKIAA4070
AK122432	1.9e-05	31.4	mKIAA1060
AK122298	1.9e-05	25.5	mKIAA0511

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR011644 7 178 PF07700 Heme NO binding

IPR011645 207 417 PF07701 Heme NO binding associated

IPR001054 418 612 PF00211 Adenylyl cyclase class-3/4/guanylyl cyclase

HMMSmart IPR001054 391 592 SM00044 Adenylyl cyclase class-3/4/guanylyl cyclase

ProfileScan IPR001054 427 560 PS50125 Adenylyl cyclase class-3/4/guanylyl cyclase

ScanRegExp IPR001054 537 560 PS00452 Adenylyl cyclase class-3/4/guanylyl cyclase

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011644	7	178	PF07700	Heme NO binding
IPR011645	207	417	PF07701	Heme NO binding associated
IPR001054	418	612	PF00211	Adenylyl cyclase class-3/4/guanylyl cyclase
HMMSmart	IPR001054	391	592	SM00044	Adenylyl cyclase class-3/4/guanylyl cyclase
ProfileScan	IPR001054	427	560	PS50125	Adenylyl cyclase class-3/4/guanylyl cyclase
ScanRegExp	IPR001054	537	560	PS00452	Adenylyl cyclase class-3/4/guanylyl cyclase

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1250 bp
Genome contig ID	gi65492966r_81661066
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- AGTGCGCATTAATTTAATAAAATGGTATTGACACT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTTGCGATTTTTCTTAATCTTTTATTTAAAGGCATTTTATAACCTTGTT

Gene/Protein Characteristic Table for mKIAA4084

Features of the cloned DNA sequence

Features of the protein sequence