ROUGE |
Gene/Protein Characteristic Table for mKIAA4083 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK220477 |
---|---|
mfj00122 [Vector Info] | |
Source : | Mouse fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4885 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 3809 bp Genome contig ID gi65492966r_52982808 PolyA signal sequence
(AATAAA,-17) +----*----+----*----+----*----+----
TACTTTCAGCAATAATCAAATAAAAATTTTGATGTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAAAATTTATTGGCTTTATTCATTTTACAAAACATAGTTACACGCATGAA
Features of the protein sequence |
Description | |
Coding region: 387..1073
Length: 229 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001258 | 45 | 75 | PF01436 | NHL repeat |
IPR001258 | 95 | 122 | PF01436 | NHL repeat | |
IPR001258 | 189 | 217 | PF01436 | NHL repeat |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |