| ROUGE |
Gene/Protein Characteristic Table for mKIAA4064 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK220467 |
|---|---|
| Protein-tyrosine phosphatase-like N precursor. | |
| mbh02927 [Vector Info] | |
| Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 3495 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 509 bp Genome contig ID gi65488608r_75434602 PolyA signal sequence
(AATAAA,-34)
GAATAAAGTTAGTGTGTTGTCTGTGCAGCTGCAACFlanking genome sequence
(100000 - 99951)
ACGGATGCCTTTGAGGCGCTGTCTGTCATGCTTCCGGGCTCCAGTGTCCC
Features of the protein sequence |
Description | |
Coding region: 2..2983
Length: 994 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| FPrintScan | IPR000242 | 778 | 785 | PR00700 | Tyrosine specific protein phosphatase |
| IPR000242 | 795 | 815 | PR00700 | Tyrosine specific protein phosphatase | |
| IPR000242 | 880 | 897 | PR00700 | Tyrosine specific protein phosphatase | |
| IPR000242 | 919 | 937 | PR00700 | Tyrosine specific protein phosphatase | |
| IPR000242 | 951 | 966 | PR00700 | Tyrosine specific protein phosphatase | |
| IPR000242 | 967 | 977 | PR00700 | Tyrosine specific protein phosphatase | |
| HMMPfam | IPR000242 | 749 | 983 | PF00102 | Tyrosine specific protein phosphatase |
| HMMSmart | IPR000242 | 723 | 986 | SM00194 | Tyrosine specific protein phosphatase |
| IPR003595 | 881 | 983 | SM00404 | Protein tyrosine phosphatase | |
| ProfileScan | IPR000242 | 724 | 984 | PS50055 | Tyrosine specific protein phosphatase |
| IPR000387 | 903 | 975 | PS50056 | Tyrosine specific protein phosphatase and dual specificity protein phosphatase | |
| ScanRegExp | IPR000387 | 922 | 934 | PS00383 | Tyrosine specific protein phosphatase and dual specificity protein phosphatase |
| Method | From | To | amino acid sequence |
|---|---|---|---|
| SOSUI | 32 | 54 | LRLLVCLLLLSGRPGGCSAISAH |
| 589 | 611 | MRSVLLTLVALAGVAGLLVALAV |
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage 
| |
