ROUGE |
Gene/Protein Characteristic Table for mKIAA4044 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK220171 |
---|---|
Receptor-type protein-tyrosine phosphatase mu precursor. | |
mpg00593 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4738 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 678 bp Genome contig ID gi65550231r_64334514 PolyA signal sequence
(ATTAAA,-23) +----*----+----*----+----*----+----
AATTATTTATTCATTAAAAGAATTTTTTGTGACGCFlanking genome sequence
(99930 - 99881) ----+----*----+----*----+----*----+----*----+----*
ACAGTGGGTGGCAATCATTTTTACTAAGCCCAAGAAATGACGGATTGTAT
Features of the protein sequence |
Description | |
Coding region: 2..4057
Length: 1352 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |