| ROUGE |
Gene/Protein Characteristic Table for mKIAA4051 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK220458 |
|---|---|
| Aryl hydrocarbon receptor nuclear translocator. | |
| mbh02817 [Vector Info] | |
| Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4497 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1846 bp Genome contig ID gi65492966f_94854163 PolyA signal sequence
(None)
GCAAAGATTTTAAAACAAAGTATTTTTTCTTTTATFlanking genome sequence
(130908 - 130957)
AAATTGTGTTGTGTTGTGTGATATTATTGATTGCGGCTCCCTGACCCCTT
Features of the protein sequence |
Description | |
Coding region: 486..2648
Length: 721 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage 
| |
