ROUGE

Gene/Protein Characteristic Table for mKIAA0307

Link to : HUGE \| InGAP \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AB093225
Description :	Aryl hydrocarbon receptor nuclear translocator 2.
Clone Name :	mbg05988 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 6247 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3775 bp

Genome contig ID gi65511124r_78000196
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
AAATTTTCATTACAATAAAAAATGACTTTGCTCTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAGTGAGTGCCTTGGACTGGCTTGGTAATTGATCAACTTGAGGTATTTG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0307 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0307	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 295..2472
Length: 725 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q61324	100.0	Aryl hydrocarbo...	Mus musculus
BAA09799	99.9	Arnt2 [Mus musc...	Mus musculus
AAH54546	99.9	Aryl hydrocarbo...	Mus musculus
Q78E60	99.4	Aryl hydrocarbo...	Rattus norvegicus
AAB05247	99.4	aryl hydrocarbo...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220458	2.8e-74	61.1	mKIAA4051

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001067 91 106 PR00785 Nuclear translocator

IPR001067 111 131 PR00785 Nuclear translocator

IPR001067 141 164 PR00785 Nuclear translocator

IPR001067 166 185 PR00785 Nuclear translocator

IPR001067 198 216 PR00785 Nuclear translocator

IPR001067 244 257 PR00785 Nuclear translocator

IPR001067 290 309 PR00785 Nuclear translocator

IPR001067 322 338 PR00785 Nuclear translocator

IPR001067 349 366 PR00785 Nuclear translocator

HMMPfam IPR001092 77 130 PF00010 Basic helix-loop-helix dimerisation region bHLH

IPR000014 150 257 PF00989 PAS

IPR000014 338 451 PF00989 PAS

HMMSmart IPR001092 82 135 SM00353 Basic helix-loop-helix dimerisation region bHLH

IPR000014 150 217 SM00091 PAS

IPR000014 338 404 SM00091 PAS

IPR001610 411 454 SM00086 PAC motif

HMMTigr IPR000014 334 461 TIGR00229 PAS

ProfileScan IPR001092 77 130 PS50888 Basic helix-loop-helix dimerisation region bHLH

NULL 86 127 PS50037 NULL

IPR000014 147 222 PS50112 PAS

IPR000014 355 406 PS50112 PAS

NULL 516 633 PS50324 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001067	91	106	PR00785	Nuclear translocator
IPR001067	111	131	PR00785	Nuclear translocator
IPR001067	141	164	PR00785	Nuclear translocator
IPR001067	166	185	PR00785	Nuclear translocator
IPR001067	198	216	PR00785	Nuclear translocator
IPR001067	244	257	PR00785	Nuclear translocator
IPR001067	290	309	PR00785	Nuclear translocator
IPR001067	322	338	PR00785	Nuclear translocator
IPR001067	349	366	PR00785	Nuclear translocator
HMMPfam	IPR001092	77	130	PF00010	Basic helix-loop-helix dimerisation region bHLH
IPR000014	150	257	PF00989	PAS
IPR000014	338	451	PF00989	PAS
HMMSmart	IPR001092	82	135	SM00353	Basic helix-loop-helix dimerisation region bHLH
IPR000014	150	217	SM00091	PAS
IPR000014	338	404	SM00091	PAS
IPR001610	411	454	SM00086	PAC motif
HMMTigr	IPR000014	334	461	TIGR00229	PAS
ProfileScan	IPR001092	77	130	PS50888	Basic helix-loop-helix dimerisation region bHLH
NULL	86	127	PS50037	NULL
IPR000014	147	222	PS50112	PAS
IPR000014	355	406	PS50112	PAS
NULL	516	633	PS50324	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3775 bp
Genome contig ID	gi65511124r_78000196
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- AAATTTTCATTACAATAAAAAATGACTTTGCTCTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAGTGAGTGCCTTGGACTGGCTTGGTAATTGATCAACTTGAGGTATTTG

Gene/Protein Characteristic Table for mKIAA0307

Features of the cloned DNA sequence

Features of the protein sequence