ROUGE

Gene/Protein Characteristic Table for mKIAA4045

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220454
Description :
Clone Name :	mbg13096 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 6519 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4125 bp

Genome contig ID gi65546577r_97239517
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
TCTCTCGAGAAATAAATGTACCCACGGAAGACTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGCCGAGTTGGTTCCGAGTGCCGTGCTGTCCTGAGAGACCCAGAGGCTT

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 220..2391
Length: 724 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH43688	100.0	RIKEN cDNA 5830...	Mus musculus
AAH62389	90.2	Similar to RIKE...	Rattus norvegicus
EDL03645	100.0	RIKEN cDNA 5830...	Mus musculus
BAE25577	99.8	unnamed protein...	Mus musculus
BAE41447	99.7	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122237	1.2e-05	27.0	mKIAA0285

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	4125 bp
Genome contig ID	gi65546577r_97239517
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- TCTCTCGAGAAATAAATGTACCCACGGAAGACTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGCCGAGTTGGTTCCGAGTGCCGTGCTGTCCTGAGAGACCCAGAGGCTT

Gene/Protein Characteristic Table for mKIAA4045

Features of the cloned DNA sequence

Features of the protein sequence