ROUGE

Gene/Protein Characteristic Table for mKIAA0285

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122237
Description :	Transmembrane protein 24.
Clone Name :	mbg06059 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4932 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 3701 bp

Genome contig ID gi65519420r_44199070
PolyA signal sequence
(ATTAAA,-23)
+----*----+----*----+----*----+----
TTAATTTATTTAATTAAAATCAAATTGGAGTTTAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAACGGGAGTGGCTGGTTATCCTTTGAAAAGCAAACAGGCCTAAAGGCTG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0285 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0285	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 311..1141, 2383..2589, 3425..4090
Length: 567 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAC30281	5.7e-92	74.2	unnamed protein...	Mus musculus
BAE32190	6.1e-92	76.6	unnamed protein...	Mus musculus
EDL25576	6.1e-92	76.8	mCG10723 [Mus m...	Mus musculus
Q80X80	6.1e-92	76.6	C2 domain-conta...	Mus musculus
AAH85925	6.7e-90	75.2	Transmembrane p...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220454	0.00036	26.9	mKIAA4045

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

None - - - - -

Search method	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

SOSUI 20 42 VGWAALLVLFAASLITVLGWMLQ

Method	From	To	amino acid sequence
SOSUI	20	42	VGWAALLVLFAASLITVLGWMLQ

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	3701 bp
Genome contig ID	gi65519420r_44199070
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- TTAATTTATTTAATTAAAATCAAATTGGAGTTTAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAACGGGAGTGGCTGGTTATCCTTTGAAAAGCAAACAGGCCTAAAGGCTG

Gene/Protein Characteristic Table for mKIAA0285

Features of the cloned DNA sequence

Features of the protein sequence