ROUGE |
Gene/Protein Characteristic Table for mKIAA4043 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK220282 |
---|---|
similar to TRIM9-like protein TNL. | |
mic35030 [Vector Info] | |
Source : | Mouse adult pancreatic islet |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4851 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 3049 bp Genome contig ID gi65515060f_123980880 PolyA signal sequence
(AATAAA,-25) +----*----+----*----+----*----+----
ACAGCAGTTTAATAAATGCCTCTCTTGTCAACCTCFlanking genome sequence
(104852 - 104901) ----+----*----+----*----+----*----+----*----+----*
AATGGCTCTGCTTGGTAATGAGACCACCAGAGAAACACACGGATCTCTGC
Features of the protein sequence |
Description | |
Coding region: 234..1799
Length: 522 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000315 | 232 | 280 | PF00643 | Zinc finger |
IPR000315 | 319 | 359 | PF00643 | Zinc finger | |
HMMSmart | IPR001841 | 39 | 189 | SM00184 | Zinc finger |
IPR000315 | 230 | 280 | SM00336 | Zinc finger | |
IPR000315 | 317 | 359 | SM00336 | Zinc finger | |
ProfileScan | IPR000315 | 237 | 280 | PS50119 | Zinc finger |
IPR000315 | 317 | 359 | PS50119 | Zinc finger | |
NULL | 400 | 493 | PS50316 | NULL | |
ScanRegExp | IPR001841 | 54 | 63 | PS00518 | Zinc finger |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |