ROUGE

Gene/Protein Characteristic Table for mKIAA4029

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220168
Description :	Segment polarity protein dishevelled homolog DVL-1.
Clone Name :	mpm12003 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 4773 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2317 bp

Genome contig ID gi65493515f_154239829
PolyA signal sequence
(ACTAAA,-26)
+----*----+----*----+----*----+----
ATTTTAAACACTAAAAAAGCGTTTAATTTTATGGG
Flanking genome sequence
(111838 - 111887)
----+----*----+----*----+----*----+----*----+----*
ACTGATGTGTGGCTTGTTTCTCTTTTCTCCAGCTGAGCTGCTCCGGGATT

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 1236..2453
Length: 406 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL15044	1.6e-123	100.0	dishevelled, ds...	Mus musculus
EDL15043	7.7e-110	95.8	dishevelled, ds...	Mus musculus
AAA74049	8.7e-110	95.8	dishevelled-1 p...	Mus musculus
BAE33208	8.8e-110	95.8	unnamed protein...	Mus musculus
P51141	8.8e-110	95.8	Segment polarit...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001478 31 117 PF00595 PDZ/DHR/GLGF

IPR000591 206 278 PF00610 Pleckstrin/ G-protein

HMMSmart IPR001478 41 120 SM00228 PDZ/DHR/GLGF

IPR000591 206 280 SM00049 Pleckstrin/ G-protein

ProfileScan IPR001478 31 104 PS50106 PDZ/DHR/GLGF

IPR000591 206 280 PS50186 Pleckstrin/ G-protein

IPR000694 305 372 PS50099 Proline-rich region

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001478	31	117	PF00595	PDZ/DHR/GLGF
IPR000591	206	278	PF00610	Pleckstrin/ G-protein
HMMSmart	IPR001478	41	120	SM00228	PDZ/DHR/GLGF
IPR000591	206	280	SM00049	Pleckstrin/ G-protein
ProfileScan	IPR001478	31	104	PS50106	PDZ/DHR/GLGF
IPR000591	206	280	PS50186	Pleckstrin/ G-protein
IPR000694	305	372	PS50099	Proline-rich region

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	2317 bp
Genome contig ID	gi65493515f_154239829
PolyA signal sequence (ACTAAA,-26)	+--------+--------+----*----+---- ATTTTAAACACTAAAAAAGCGTTTAATTTTATGGG
Flanking genome sequence (111838 - 111887)	----+--------+--------+--------+--------+----* ACTGATGTGTGGCTTGTTTCTCTTTTCTCCAGCTGAGCTGCTCCGGGATT

Gene/Protein Characteristic Table for mKIAA4029

Features of the cloned DNA sequence

Features of the protein sequence