ROUGE |
Gene/Protein Characteristic Table for mKIAA4025 |
Link to : HUGE | InGAP | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK220167 |
---|---|
Heat shock 70-related protein APG-2. | |
mpg01178 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4596 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1803 bp Genome contig ID gi65527427r_52912656 PolyA signal sequence
(AATAAA,-32) +----*----+----*----+----*----+----
ACTAATAAAAGAAACCTGTCTTAACTTGAAAAAACFlanking genome sequence
(240617 - 240568) ----+----*----+----*----+----*----+----*----+----*
ACATTTTTCTTTTCCCCCTTGGGTGGCTCTGTTTCTTTGTAAGGCTTCCC
Features of the protein sequence |
Description | |
Coding region: 1..2790
Length: 930 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |