ROUGE

Gene/Protein Characteristic Table for mKIAA4021

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	BC040346
Description :	thyroid hormone receptor associated protein 3.
Clone Name :	mfj33210 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 4290 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1298 bp

Genome contig ID gi65493515r_125091212
PolyA signal sequence
(AATAAA,-8)
+----*----+----*----+----*----+----
GTTTCAACTCCTCCTGCAAATAAAAACAATAAATG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGTGGCAGATGTAAACGGACTGTGTTTGTTGCTTGTGTGAGTGACCCTG

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 119..2989
Length: 957 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q569Z6	100.0	Thyroid hormone...	Mus musculus
Q5BJ39	99.9	Thyroid hormone...	Xenopus laevis
Q5M7V8	98.2	Thyroid hormone...	Rattus norvegicus
XP_581483	93.1	similar to thyr...	Bos taurus
XP_001503684	92.2	similar to thyr...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK129071	1.9e-19	37.0	mKIAA0164
AK122418	0.00046	27.7	mKIAA1019

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan NULL 4 345 PS50324 NULL

NULL 18 167 PS50323 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	NULL	4	345	PS50324	NULL
NULL	18	167	PS50323	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1298 bp
Genome contig ID	gi65493515r_125091212
PolyA signal sequence (AATAAA,-8)	+--------+--------+----*----+---- GTTTCAACTCCTCCTGCAAATAAAAACAATAAATG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGTGGCAGATGTAAACGGACTGTGTTTGTTGCTTGTGTGAGTGACCCTG

Gene/Protein Characteristic Table for mKIAA4021

Features of the cloned DNA sequence

Features of the protein sequence