ROUGE

Gene/Protein Characteristic Table for mKIAA0164

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129071
Description :	Bcl-2-associated transcription factor 1.
Clone Name :	mbg09610 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4736 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2442 bp

Genome contig ID gi65524842f_20150567
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
AAATTGTCATATGCCAATAAAATGTCCTAAGTGGT
Flanking genome sequence
(119140 - 119189)
----+----*----+----*----+----*----+----*----+----*
AATAGCTGGTCTCTGTTTGCCTGACGTTGAGGCTATCGCTGCTTGAACTC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0164 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0164	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..2294
Length: 763 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH34300	100.0	BCL2-associated...	Mus musculus
Q8K019	100.0	Bcl-2-associate...	Mus musculus
EDL03431	100.0	mCG2822, isofor...	Mus musculus
EDL93801	97.5	BCL2-associated...	Rattus norvegicus
BAE29048	99.9	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
BC040346	1.9e-22	37.0	mKIAA4021

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan NULL 65 133 PS50324 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	NULL	65	133	PS50324	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2442 bp
Genome contig ID	gi65524842f_20150567
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- AAATTGTCATATGCCAATAAAATGTCCTAAGTGGT
Flanking genome sequence (119140 - 119189)	----+--------+--------+--------+--------+----* AATAGCTGGTCTCTGTTTGCCTGACGTTGAGGCTATCGCTGCTTGAACTC

Gene/Protein Characteristic Table for mKIAA0164

Features of the cloned DNA sequence

Features of the protein sequence