ROUGE

Gene/Protein Characteristic Table for mKIAA4008

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220275
Description :	glucosamine-6-phosphate deaminase 2. oscillin. glucosamine-6-phosphate isomerase.
Clone Name :	mib36077 [Vector Info]
Source :	Mouse adult pancreatic islet

Features of the cloned DNA sequence	Description

Length: 6251 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2792 bp

Genome contig ID gi65498774r_68244007
PolyA signal sequence
(AATAAA,-15)
+----*----+----*----+----*----+----
TTATACCTAGCTACAAATTAAATAAAATCCTTTTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAACATTTTCTGATTATTGTTAAATTTTGTAAATCATCCTTATATATG

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 3010..3456
Length: 149 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_858814	1.8e-51	95.5	similar to gluc...	Canis lupus fam...
XP_858777	2.3e-50	97.6	similar to gluc...	Canis lupus fam...
BAD93141	2.5e-50	97.6	glucosamine-6-p...	Homo sapiens
XP_858737	2.9e-50	95.4	similar to gluc...	Canis lupus fam...
EDL37803	4.4e-50	97.6	mCG10526, isofo...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK172879	2.5e-54	91.9	mKIAA0060

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR006148 1 140 PF01182 Glucosamine/galactosamine-6-phosphate isomerase

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006148	1	140	PF01182	Glucosamine/galactosamine-6-phosphate isomerase

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2792 bp
Genome contig ID	gi65498774r_68244007
PolyA signal sequence (AATAAA,-15)	+--------+--------+----*----+---- TTATACCTAGCTACAAATTAAATAAAATCCTTTTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAACATTTTCTGATTATTGTTAAATTTTGTAAATCATCCTTATATATG

Gene/Protein Characteristic Table for mKIAA4008

Features of the cloned DNA sequence

Features of the protein sequence