| ROUGE |
Gene/Protein Characteristic Table for mKIAA4005 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK220444 |
|---|---|
| female sterile homeotic-related gene 1. bromodomain-containing 2. |
|
| mfj27181 [Vector Info] | |
| Source : | Mouse fetal brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 3625 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 546 bp Genome contig ID gi65550231r_31717642 PolyA signal sequence
(AATAAA,-19)
TTGAGTCTAACATGTAAATAAAGAAAATATTATTGFlanking genome sequence
(100000 - 99951)
AAGTTTTGAGTTAGTTTTCTTAGTGAGATTTGTTTCTGTGTTCAAAGTGG
Features of the protein sequence |
Description | |
Coding region: 623..3076
Length: 818 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage 
| |
