ROUGE |
Gene/Protein Characteristic Table for mKIAA2028 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK173337 |
---|---|
mib04094 [Vector Info] | |
Source : | Mouse adult pancreatic islet |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6535 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 2327 bp Genome contig ID gi65550231f_82286901 PolyA signal sequence
(AATAAA,-27) +----*----+----*----+----*----+----
ACAGTTACAATAAATGATTTTCGAGTTCCGTTTCGFlanking genome sequence
(164685 - 164734) ----+----*----+----*----+----*----+----*----+----*
AACATTATCTTTTGAATAATCTTCAAAAATGCCTAACAGTTTCATTGTCG
KIAA Alignment based on: KIAA2028 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 1..1836, 1866..4208
Length: 1392 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |