ROUGE

Gene/Protein Characteristic Table for mKIAA2022

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220439
Description :	BA130N24.1 (Fragment).
Clone Name :	mfj41200 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 5029 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 138 bp

Genome contig ID gi66880665r_98585093
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GAGACTCTTTCCCATTCTCCTCTTTTTTTCAAATT
Flanking genome sequence
(99987 - 99938)
----+----*----+----*----+----*----+----*----+----*
AAAAAGAAAAGAAAAAAATGCATGGAAATCCCTGTACCTTTAAGCCACCC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA2022 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA2022	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 422..4891
Length: 1489 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_217568	94.1	similar to DNA ...	Rattus norvegicus
XP_001096699	85.1	similar to DNA ...	Macaca mulatta
EDL14086	99.9	mCG1188 [Mus mu...	Mus musculus
XP_549086	84.1	similar to DNA ...	Canis lupus fam...
XP_001056559	92.6	similar to DNA ...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	138 bp
Genome contig ID	gi66880665r_98585093
PolyA signal sequence (None)	+--------+--------+----*----+---- GAGACTCTTTCCCATTCTCCTCTTTTTTTCAAATT
Flanking genome sequence (99987 - 99938)	----+--------+--------+--------+--------+----* AAAAAGAAAAGAAAAAAATGCATGGAAATCCCTGTACCTTTAAGCCACCC

Gene/Protein Characteristic Table for mKIAA2022

Features of the cloned DNA sequence

Features of the protein sequence