Order Kazusa clone(s) from : ![]() |
Product ID | ORK05747 |
---|---|
Accession No | AB095942 |
Description | KIAA2022 |
Clone name | ff04229 |
Vector information | |
cDNA sequence | DNA sequence (10624 bp) Predicted protein sequence (1520 aa) |
Flexi ORF Clone |
FXC05747
![]() |
Source | Human fetal brain |
Rouge ID |
mKIAA2022
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 5828 bp |
---|---|
Genome contig ID | gi89161218r_73770137 |
PolyA signal sequence (AATAAA,-17) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | CAGGATTGGGGTTACTTCGAG |
---|---|
Primer_r | TCGAATTTTCAGGGAGCAGAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |