KIAA2021

Product ID	ORK00310
Accession No	AB095941
Description	NOP9 nucleolar protein, transcript variant 1
Clone name	ah05004
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6033 bp) Predicted protein sequence (648 aa)
HaloTag ORF Clone	FHC00310
Flexi ORF Clone	FXC00310
Source	Human brain (amygdala)
Rouge ID	mKIAA2021 by Kazusa Mouse cDNA Project

Length: 6033 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	4029 bp
Genome contig ID	gi51511730f_23738908
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TAAGTACATTCTCCTAATAAATGCTTTGGACTGAT
Flanking genome sequence (109264 - 109313)	----+--------+--------+--------+--------+----* CACCCTGCCAGTCTTTTGTCTTGGGCAATCTATACTTTTCTCAGAGGTTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	f	23838908	23848170	10	99.3	Perfect prediction

Length: 648 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q86U38	0	100.0	Pumilio domain-...	Homo sapiens
EAW66035	0	99.7	chromosome 14 o...	Homo sapiens
CAI46005	0	99.5	hypothetical pr...	Homo sapiens
XP_001113913	0	96.4	similar to Prot...	Macaca mulatta
AAI40559	2.2e-210	88.7	LOC528833 prote...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001313	104	135	PF00806	Pumilio/Puf RNA-binding
	IPR001313	201	235	PF00806	Pumilio/Puf RNA-binding
	IPR001313	325	360	PF00806	Pumilio/Puf RNA-binding
	IPR001313	363	398	PF00806	Pumilio/Puf RNA-binding
	IPR001313	521	556	PF00806	Pumilio/Puf RNA-binding
	IPR001313	559	593	PF00806	Pumilio/Puf RNA-binding
HMMSmart	IPR001313	201	232	SM00025	Pumilio/Puf RNA-binding
	IPR001313	275	310	SM00025	Pumilio/Puf RNA-binding
	IPR001313	326	361	SM00025	Pumilio/Puf RNA-binding
	IPR001313	363	399	SM00025	Pumilio/Puf RNA-binding
	IPR001313	521	558	SM00025	Pumilio/Puf RNA-binding
	IPR001313	559	594	SM00025	Pumilio/Puf RNA-binding

Primer_f	GTAGGGGATTAGATGTAGCAG
Primer_r	CCTTTCAGCATAACGCCTCAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-