ROUGE |
Gene/Protein Characteristic Table for mKIAA2010 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK173331 |
---|---|
meh00005 [Vector Info] | |
Source : | Mouse embryonic intestinal tract |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6153 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 4044 bp Genome contig ID gi65532617r_96384979 PolyA signal sequence
(AATAAA,-22) +----*----+----*----+----*----+----
TTGACTTTTGAATAATAAAAAGAAAAGTGAAGAGTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAGAGAAATTGTATTAATTGTATGTTTCTTTTCTTTCTTTCTTTTTTTTT
KIAA Alignment based on: KIAA2010 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 652..1962, 3768..5003
Length: 848 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR006887 | 192 | 385 | PF04802 | Protein of unknown function DUF625 |
ProfileScan | IPR000697 | 29 | 133 | PS50229 | EVH1 |
IPR008160 | 781 | 797 | PS50288 | Collagen triple helix repeat |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |