KIAA2010

Product ID	ORK00308
Accession No	AB095930
Description	protein phosphatase 4, regulatory subunit 3A, transcript variant 3
Clone name	fj14762
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4106 bp) Predicted protein sequence (920 aa)
HaloTag ORF Clone	FHC00308
Flexi ORF Clone	FXC00308
Source	Human fetal brain
Rouge ID	mKIAA2010 by Kazusa Mouse cDNA Project

Length: 4106 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1146 bp
Genome contig ID	gi51511730r_90893711
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- TTTTTAATAATAAAAAGAAAAGTGAAGAGTAAGAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATTGTATTAGTTGTATGTTTCTTGTTTTTGTTTTTAACTACTCCCTTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	r	90993711	91046241	15	99.7	Perfect prediction

Length: 920 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001140788	100.0	hypothetical pr...	Pan troglodytes
XP_001928870	99.4	SMEK homolog 1,...	Sus scrofa
XP_854423	99.4	similar to CG93...	Canis lupus fam...
Q6P2K6	99.3	Serine/threonin...	Mus musculus
XP_001790690	98.8	SMEK homolog 1,...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037808	2.9e-98	71.8	KIAA1387

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006887	264	457	PF04802	Protein of unknown function DUF625

Primer_f	GCCTCTTACACTTGACTTCTG
Primer_r	TTCCACTTACAAAACCCCTGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-