ROUGE

Gene/Protein Characteristic Table for mKIAA1996

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	BC061484
Description :	acyl-Coenzyme A binding domain containing 5.
Clone Name :	msj10320 [Vector Info]
Source :	Mouse adult spleen

Features of the cloned DNA sequence	Description

Length: 3006 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1993 bp

Genome contig ID gi66880554f_22919672
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
AACTAAGTTAAAAAATAAAAGGTTAATGAGAAATG
Flanking genome sequence
(127003 - 127052)
----+----*----+----*----+----*----+----*----+----*
AAATGCTAACTGTATTGACTGTGTACAAAGCTAAAGCAAGAAGCAACAGT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1996 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1996	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..1013
Length: 336 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAB23735	8e-128	100.0	unnamed protein...	Mus musculus
NP_001095907	8.4e-128	100.0	acyl-Coenzyme A...	Mus musculus
AAH90641	8.5e-128	100.0	Acbd5 protein [...	Mus musculus
BAC34262	8.4e-127	99.7	unnamed protein...	Mus musculus
Q5XG73	8.9e-127	99.7	Acyl-CoA-bindin...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1993 bp
Genome contig ID	gi66880554f_22919672
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- AACTAAGTTAAAAAATAAAAGGTTAATGAGAAATG
Flanking genome sequence (127003 - 127052)	----+--------+--------+--------+--------+----* AAATGCTAACTGTATTGACTGTGTACAAAGCTAAAGCAAGAAGCAACAGT

Gene/Protein Characteristic Table for mKIAA1996

Features of the cloned DNA sequence

Features of the protein sequence