KIAA1996

Product ID	ORK04022
Accession No	AB082527
Description	acyl-CoA binding domain containing 5, transcript variant 3
Clone name	bj00079
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCT TTTTTTTTTT TTTTTTT-3' end of cDNA).
cDNA sequence	DNA sequence (3682 bp) Predicted protein sequence (437 aa)
HaloTag ORF Clone	FHC04022
Flexi ORF Clone	FXC04022
Source	Human adult brain
Rouge ID	mKIAA1996 by Kazusa Mouse cDNA Project

Length: 3682 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2210 bp
Genome contig ID	gi89161187r_27424155
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- TTGTAAAACTAAGTTAAAAATAAAAGGTTAATGAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATGATATGGCTTTTATTACTTGTTACTATTAGCCCATTGATTAGGTAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	r	27524155	27571023	12	99.3	Perfect prediction

Length: 437 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH30555	2.7e-158	98.8	Acyl-Coenzyme A...	Homo sapiens
BAH11953	2.8e-158	98.8	unnamed protein...	Homo sapiens
CAI16915	2.8e-158	98.8	acyl-Coenzyme A...	Homo sapiens
Q5R7V3	4.2e-154	96.1	Acyl-CoA-bindin...	Pongo abelii
CAI16911	1.4e-153	100.0	acyl-Coenzyme A...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000582	6	37	PD351532	Acyl-coA-binding protein
HMMPfam	IPR000582	13	43	PF00887	Acyl-coA-binding protein
ProfileScan	IPR000582	1	44	PS51228	Acyl-coA-binding protein

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	405	EMSPGVLTFAIIWPFIAQWLVYL	427	PRIMARY	23

Primer_f	TATCTTAGTCACGGAGTTGCC
Primer_r	ATCAGTGGGTTATGTCTAGCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-