ROUGE

Gene/Protein Characteristic Table for mKIAA1988

Link to : HUGE \| InGAP \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173318
Description :	Cirhin (Fragment).
Clone Name :	msj02270 [Vector Info]
Source :	Mouse adult spleen

Features of the cloned DNA sequence	Description

Length: 2183 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 106 bp

Genome contig ID gi65515060f_106092277
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TCCCAAATCATGATAATAAAACAAAGTTATTCTTT
Flanking genome sequence
(128500 - 128549)
----+----*----+----*----+----*----+----*----+----*
AGGACTAGACATTTTAAATTATTTTCTAAAAGAATGAGCACAGATTTCCT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1988 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1988	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..2077
Length: 691 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8R2N2	100.0	Cirhin; Testis-...	Mus musculus
BAE27022	99.9	unnamed protein...	Mus musculus
AAH88461	97.2	Cirrhosis, auto...	Rattus norvegicus
BAC11214	90.1	unnamed protein...	Homo sapiens
XP_001497169	90.4	similar to Cirh...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK131137	8.4e-05	22.8	mFLJ00137

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001680 12 49 PF00400 WD-40 repeat

IPR001680 97 134 PF00400 WD-40 repeat

IPR001680 141 177 PF00400 WD-40 repeat

IPR001680 283 318 PF00400 WD-40 repeat

IPR001680 477 517 PF00400 WD-40 repeat

IPR001680 522 559 PF00400 WD-40 repeat

HMMSmart IPR001680 10 49 SM00320 WD-40 repeat

IPR001680 53 92 SM00320 WD-40 repeat

IPR001680 95 134 SM00320 WD-40 repeat

IPR001680 139 177 SM00320 WD-40 repeat

IPR001680 190 227 SM00320 WD-40 repeat

IPR001680 230 269 SM00320 WD-40 repeat

IPR001680 281 318 SM00320 WD-40 repeat

IPR001680 431 470 SM00320 WD-40 repeat

IPR001680 475 517 SM00320 WD-40 repeat

IPR001680 520 559 SM00320 WD-40 repeat

ProfileScan IPR001680 17 327 PS50294 WD-40 repeat

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001680	12	49	PF00400	WD-40 repeat
IPR001680	97	134	PF00400	WD-40 repeat
IPR001680	141	177	PF00400	WD-40 repeat
IPR001680	283	318	PF00400	WD-40 repeat
IPR001680	477	517	PF00400	WD-40 repeat
IPR001680	522	559	PF00400	WD-40 repeat
HMMSmart	IPR001680	10	49	SM00320	WD-40 repeat
IPR001680	53	92	SM00320	WD-40 repeat
IPR001680	95	134	SM00320	WD-40 repeat
IPR001680	139	177	SM00320	WD-40 repeat
IPR001680	190	227	SM00320	WD-40 repeat
IPR001680	230	269	SM00320	WD-40 repeat
IPR001680	281	318	SM00320	WD-40 repeat
IPR001680	431	470	SM00320	WD-40 repeat
IPR001680	475	517	SM00320	WD-40 repeat
IPR001680	520	559	SM00320	WD-40 repeat
ProfileScan	IPR001680	17	327	PS50294	WD-40 repeat

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	106 bp
Genome contig ID	gi65515060f_106092277
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TCCCAAATCATGATAATAAAACAAAGTTATTCTTT
Flanking genome sequence (128500 - 128549)	----+--------+--------+--------+--------+----* AGGACTAGACATTTTAAATTATTTTCTAAAAGAATGAGCACAGATTTCCT

Gene/Protein Characteristic Table for mKIAA1988

Features of the cloned DNA sequence

Features of the protein sequence