| ROUGE |
Gene/Protein Characteristic Table for mFLJ00137 |
| Link to : NEDO | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK131137 |
|---|---|
| Gem-associated protein 5. | |
| mbh01290 [Vector Info] | |
| Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4896 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 449 bp Genome contig ID gi65527427r_57746798 PolyA signal sequence
(ACTAAA,-20)
CTGCCCACCTCAAAGACTAAAGGAATTAGCCTTGGFlanking genome sequence
(100000 - 99951)
AACATTAGGTTATTTTATTTTTTACGGAGTTGGTTACATGGACAAGTAGC
KIAA Alignment based on: FLJ00137 DNA sequence
Features of the protein sequence |
Description | |
Coding region: 257..4447
Length: 1396 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage 
| |
